Stem-loop hsa-mir-21
Mirna Stemloop Summary
| id | hsa-mir-21 |
| Accession | MI0000077 |
| Comments | Mourelatos et al. named this sequence miR-21 precursor-17 and also reported the exact reverse complement of this predicted stem-loop sequence and erroneously assigned the name miR-104 [2]. |
| Database Links | hsa-mir-21 |
| Description | Homo sapiens miR-21 stem-loop |
| Gene Family | MIPF0000060;mir-21 |
| Genome Context | chr17: 59841266-59841337 [+] |
| miRna Matures Links | |
| Sequence | UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA |