Stem-loop hsa-mir-29b-1
Mirna Stemloop Summary
| id | hsa-mir-29b-1 |
| Accession | MI0000105 |
| Comments | Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 [1]. Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency. |
| Database Links | hsa-mir-29b-1 |
| Description | Homo sapiens miR-29b-1 stem-loop |
| Gene Family | MIPF0000009;mir-29 |
| Genome Context | chr7: 130877459-130877539 [-] |
| miRna Matures Links | |
| Sequence | CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG |