Stem-loop hsa-mir-205
Mirna Stemloop Summary
| id | hsa-mir-205 |
| Accession | MI0000285 |
| Comments | This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2]. |
| Database Links | hsa-mir-205 |
| Description | Homo sapiens miR-205 stem-loop |
| Gene Family | MIPF0000058;mir-205 |
| Genome Context | chr1: 209432133-209432242 [+] |
| miRna Matures Links | |
| Sequence | AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA |